View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2042_low_7 (Length: 269)
Name: NF2042_low_7
Description: NF2042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2042_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 14 - 253
Target Start/End: Original strand, 42779460 - 42779699
Alignment:
| Q |
14 |
caacaacaacgcgaactttagcatcattactagtcnnnnnnncacttgcagcaccaccactggttgacccttttgatgctactgacacagcttcgcgcct |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42779460 |
caacaacaacgcgaactttagcatcattactagtctttttttcacttgcagcaccaccactggttgacccttttgatgctactgacacagcttcgcgcct |
42779559 |
T |
|
| Q |
114 |
cttacgcattgtaagtaaattctaatcagcaatcacctactcaaaagagtgaaaaataacctctaaatcaacaatgccttgttccaaactacaaaacaaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42779560 |
cttacgcattgtaagtaaattctaatcagcaatcacctactcaaaagagtgaaaaataacctctaaatcaacaatgccttgttccaaactacaaaacaaa |
42779659 |
T |
|
| Q |
214 |
agcttcacacaaggaaaattaagatgtcaaatatgaattc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42779660 |
agcttcacacaaggaaaattaagatgtcaaatatgaattc |
42779699 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University