View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_high_12 (Length: 284)
Name: NF20430_high_12
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 6 - 260
Target Start/End: Original strand, 5053585 - 5053839
Alignment:
| Q |
6 |
agcagcacagaaaaagcgctcatttcacttgtttgcatcacagaatttgaatcaatttctgaaaactatacaactactattgtcccttgacggtgacaaa |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
5053585 |
agcagcacagaaaaagcgctcatttcacttgttagcatcacagaatttgaatcaatttctgaaaactatacaactactattgtccctcgacggtggcaaa |
5053684 |
T |
|
| Q |
106 |
actaatactaccaactatagattatatatagtggttctagttatgttgcaaacctttatattgcagaaaaatgcaggaataagatgtcaaaattgcggtt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5053685 |
actaatactaccaactatagattatatatagtggttctagttacgttgcaaacctttatattgcagaaaaatgcgggaataagatgtcaaaattgcggtt |
5053784 |
T |
|
| Q |
206 |
gcaatactgttgtggagactttaaaatcccttatactacagtggcaatactgttg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5053785 |
gcaatactgttgtggagactttaaaatcccttatattacagtggcaatactgttg |
5053839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 206 - 264
Target Start/End: Original strand, 5053828 - 5053886
Alignment:
| Q |
206 |
gcaatactgttgtggagactttaaaatcccttatactacagtggcaatactgttgcgga |
264 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5053828 |
gcaatactgttgtggaggcttcaaaatcccttatattaccgtggcaatactgttgcgga |
5053886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University