View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_high_14 (Length: 253)
Name: NF20430_high_14
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_high_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 237
Target Start/End: Original strand, 2592006 - 2592223
Alignment:
| Q |
20 |
aattcatgatactagtaattataatcttccaccattgatagagaataatgtggaaaacagcatggtgccaattgatcaagtgcaatcttgtaatatggat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592006 |
aattcatgatactagtaattataatcttccaccattgatagagaataatgtggaaaacagcatggtgccaattgatcaagtgcaatcttgtaatatggat |
2592105 |
T |
|
| Q |
120 |
gaggaaggaggagagttattaacattggagtcattgcaattgcaaagacaagaagagttgaatgaatgggtggaaactcaacaacaatgtcctagcttta |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2592106 |
gaggaaggaggagagttattaacattggagtcattgcaattgcaaagacaagaagagttgaatgaatgggtggaaactcaacaacaatgtcctagcttta |
2592205 |
T |
|
| Q |
220 |
ttttcagctgggagagtg |
237 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
2592206 |
ttttcagctgggagagtg |
2592223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University