View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_high_3 (Length: 367)
Name: NF20430_high_3
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_high_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 318; Significance: 1e-179; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 18 - 351
Target Start/End: Original strand, 16444079 - 16444412
Alignment:
| Q |
18 |
aagttcaggatagctactgatcatatacttttgtttgacgagcggctgctaaaatttgtggataacggagaaacagtgttttcatacaaccagtggaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
16444079 |
aagttcaggatagctactgatcatatacttttgtttgacgagcggccgctaaaatttgtggataacggagaaacagtgttttcatgcaacaagtggaatc |
16444178 |
T |
|
| Q |
118 |
atttcgaggtttcatatgaggatcttgttactgacaacggggttccaatcagagaggttgccaaatatagtggaatccatgtatctcaagaatggattga |
217 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16444179 |
atttcgaggtttcatacgaggatcttgttactgacaacggggttccaatcagagaggttgccaaatatagtggaatccatgtatctcaagaatggattga |
16444278 |
T |
|
| Q |
218 |
tattgcggatatccaattcacccaatcccggaaaacattgataaatgcaaatttggatcccaattcaatggtggagccacttcaaagaggaaaggtaaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16444279 |
tattgcggatatccaattcacccaatcccggaaaacattgataaatgcaaatttggatcccaattcaatggtggagccacttcaaagaggaaaggtaaaa |
16444378 |
T |
|
| Q |
318 |
ttcttcttttaattctcttcctttttaatcatgt |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16444379 |
ttcttcttttaattctcttcctttttaatcatgt |
16444412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 21 - 201
Target Start/End: Complemental strand, 16369478 - 16369298
Alignment:
| Q |
21 |
ttcaggatagctactgatcatatacttttgtttgacgagcggctgctaaaatttgtggataacggagaaacagtgttttcatacaaccagtggaatcatt |
120 |
Q |
| |
|
|||||| |||| || |||||||||||||| || || ||||||| ||||||||| ||||| || || || |||||| | |||| ||||||||||| |
|
|
| T |
16369478 |
ttcagggtagcaacggatcatatacttttattcgatttgcggctgttaaaatttgaagataatggggatgcattgtttttagacaatgagtggaatcatg |
16369379 |
T |
|
| Q |
121 |
tcgaggtttcatatgaggatcttgttactgacaacggggttccaatcagagaggttgccaaatatagtggaatccatgtat |
201 |
Q |
| |
|
| | ||||||||||| ||||| | |||||||||| | |||||||| |||| |||| |||||||||| ||||||||||||| |
|
|
| T |
16369378 |
tggtggtttcatatgtggatcatattactgacaatgaagttccaataagagtggtttccaaatatagcggaatccatgtat |
16369298 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University