View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_low_11 (Length: 296)
Name: NF20430_low_11
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 80 - 289
Target Start/End: Complemental strand, 31754346 - 31754137
Alignment:
| Q |
80 |
catatcctaatacatagtactcctcaaattaattagcatcgagtgacatattgcttacgacattattatgtgtaagtaaacatgtttgaaataatgcaaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31754346 |
catatcctaatacatagtactcctcaaattaattagcaccgagtgacatattgcttacgacattattatgtgtaagtaaacatgtttgaaataatgcaaa |
31754247 |
T |
 |
| Q |
180 |
tattgattcatgtcgataagcttcaattattctttggtgggaggctgacaagttccttttgtttctcttttttccctttctgattcctaaggccacatac |
279 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31754246 |
tattgattcatgtcgataagcttcaattattctttggtgggaggctgacaagttccttttgtttctcttttttccctttctgattcctaaggccacatac |
31754147 |
T |
 |
| Q |
280 |
attcttctca |
289 |
Q |
| |
|
|||||||||| |
|
|
| T |
31754146 |
attcttctca |
31754137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University