View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_low_14 (Length: 282)
Name: NF20430_low_14
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 12 - 278
Target Start/End: Original strand, 34532284 - 34532554
Alignment:
| Q |
12 |
agatagaataattaccaaggatgattctcactggctttcctcagctctttgagaggctcaggctctctagggtaaacagcagtatccaatatatactgca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532284 |
agatagaataattaccaaggatgattctcactggctttcctcagctctttgagaggctcaggctctctagggtaaacagcagtatccaatatatactgca |
34532383 |
T |
 |
| Q |
112 |
acacaattgttaatcaatgagtc----acaaatgaaatttcaagatagtaagnnnnnnnntggaattagattttcaagataaatttgtatactaacattt |
207 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34532384 |
acacaattgttaatcaatgagtcatatataaatgaaatttcaagatagtaagaaaaaaaatggaattagattttcaagataaatttgtatactaacattt |
34532483 |
T |
 |
| Q |
208 |
gttaagtcctcactctgcaatatgacaggatttttgtagattgatggatctttaacatgtttcatctctct |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
34532484 |
gttaagtcctcactctgcaatatgacaggatttttgtagattgatggatctttaacatgttccatttctct |
34532554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 12 - 135
Target Start/End: Original strand, 34520025 - 34520148
Alignment:
| Q |
12 |
agatagaataattaccaaggatgattctcactggctttcctcagctctttgagaggctcaggctctctagggtaaacagcagtatccaatatatactgca |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
34520025 |
agattgaataattaccaaggatgattctcagtggcattcctcagctctttgagaggctttggctctctagggtaaacagcaggctccaatatataatgca |
34520124 |
T |
 |
| Q |
112 |
acacaattgttaatcaatgagtca |
135 |
Q |
| |
|
||||||||||| |||||||||||| |
|
|
| T |
34520125 |
acacaattgttcatcaatgagtca |
34520148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University