View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_low_16 (Length: 244)
Name: NF20430_low_16
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 106 - 225
Target Start/End: Original strand, 31754558 - 31754677
Alignment:
| Q |
106 |
tcccactttcatattggttctcccgattaaattttttggcatccaaaatgttatttgaattcaacttgaatatgttgctcaaattgtccaatgaccaacg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31754558 |
tcccactttcatattggttctcccgattaaattttttggcatccaaaatgttatttaaattcaacttgaatatgttgctcaaattgtccaatgaccaacg |
31754657 |
T |
|
| Q |
206 |
attagggctttcacatttct |
225 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31754658 |
attagggctttcacatttct |
31754677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 31754453 - 31754505
Alignment:
| Q |
1 |
tttagagaatagcaataaatgtagtcaccgccatcatagtgagagttctatcc |
53 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
31754453 |
tttagagaatagcaataaatgtagtcaccaccatcatagtgagagttctatcc |
31754505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University