View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_low_4 (Length: 357)
Name: NF20430_low_4
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 1 - 341
Target Start/End: Complemental strand, 10595806 - 10595466
Alignment:
| Q |
1 |
acaacctccagagtagtacattggtgatggagagggaacatgaggaggataagaaggtatgtgactattgtaacaagggtaattattgtgaccatggcag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
10595806 |
acaacctccagagtagtacattggtgatggagagggaacatgaggaggataagaaggtatgtgactattgtaacaagggtaattattgtggccatagcag |
10595707 |
T |
 |
| Q |
101 |
aaatgtggtggtatagggtggttataattgctagcataaggccaaggttgttcataagggaagggtgatttggtcatttgaggaggaacaagttcaatgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
10595706 |
aaatgtggtggtatagggtggttataattgctagcataaggccaaggttgttcataagggaagggtgatttggtcatttgaggaggaacaggttccatgc |
10595607 |
T |
 |
| Q |
201 |
caggatgatggtaatgagggaatggtatttggtttctttgaaatgggtatgagtccatgtttctgtatccaggaatcatgtttgtttggaaaggttacca |
300 |
Q |
| |
|
||||| || |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595606 |
ttggatggtgataataagggaatggtatttggtttctttgaaatgggtatgagtccatgtttctgtatccaggaatcatgtttgtttggaaaggttacca |
10595507 |
T |
 |
| Q |
301 |
agaacagacagaactagattttcactggctgatcttggaaa |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595506 |
agaacagacagaactagattttcactggctgatcttggaaa |
10595466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University