View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20430_low_8 (Length: 317)
Name: NF20430_low_8
Description: NF20430
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20430_low_8 |
 |  |
|
| [»] scaffold0183 (2 HSPs) |
 |  |  |
|
| [»] scaffold0505 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0183 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: scaffold0183
Description:
Target: scaffold0183; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 58 - 242
Target Start/End: Complemental strand, 21569 - 21385
Alignment:
| Q |
58 |
tatataaagtccaagatctaactacctttcgtaatggatttgttcggtttggtattctgaacgtgttggatttttcacggttgcggtttcggaaaatggg |
157 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
21569 |
tatataaagtcctagatctaactacctttcgtaatggatttgtttgatttggtattctggacgtgttggatttttcacggttgcgttttcggaaaatggg |
21470 |
T |
 |
| Q |
158 |
ttgtatggctggatttgggtttatggtgaaacggttacgatgttcggtgatcgatggtatcgggttttggaaatatgatggtgat |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||| |||| | |||||||||||||||| ||||||| |
|
|
| T |
21469 |
ttgtatggctggatttgggtttatggtgaatcggttacgatgttcggtgatcgttggtgttgggttttggaaatatggtggtgat |
21385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0183; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 21250 - 21182
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggtttgagaagttttgatgatttgtgattaccggttttctt |
307 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21250 |
tgatgatttgatgatggtgtgtgacgagggtttgagaagttttgatgatttgtgattagtggttttctt |
21182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 59 - 243
Target Start/End: Original strand, 15060505 - 15060688
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaatggatttgttcggtttggtattctgaacgtgttggatttttcacggttgcggtttcggaaaatgggt |
158 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
15060505 |
atataaagtcctagatctaactacctttcgtaatggatttgtttggtatggtattctggacgtgttggatttttcactgttgcggtttcgaaaaatgggt |
15060604 |
T |
 |
| Q |
159 |
tgtatggctggatttgggtttatggtgaaacggttacgatgttcggtgatcgatggtatcgggttttggaaatatgatggtgatg |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||| |||||| | |||| | |||||||||||||||| |||||||| |
|
|
| T |
15060605 |
tgtatggctggattt-ggtttatggtgaatcggttacgatgtttggtgattgctggtgttgggttttggaaatatggtggtgatg |
15060688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 239 - 307
Target Start/End: Original strand, 15060822 - 15060890
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggtttgagaagttttgatgatttgtgattaccggttttctt |
307 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15060822 |
tgataattcgatgatggtgtatgacgagggtttgagaagttttgatgatttgtgattactggttttctt |
15060890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 239 - 304
Target Start/End: Original strand, 21750107 - 21750172
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggtttgagaagttttgatgatttgtgattaccggtttt |
304 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21750107 |
tgatgattcgatgatggtgtatgataagggtttgagaggttttgatgatttgtgattaccggtttt |
21750172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 29885179 - 29885109
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggttt--gagaagttttgatgatttgtgattaccggttttctt |
307 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
29885179 |
tgatgattcgatgatggtgtgtgatgagggtttgagagaggttttgatgatttgtgattactggttttctt |
29885109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 29901755 - 29901685
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggttt--gagaagttttgatgatttgtgattaccggttttctt |
307 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
29901755 |
tgatgattcgatgatggtgtgtgatgagggtttgagagaggttttgatgatttgtgattactggttttctt |
29901685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 130
Target Start/End: Original strand, 4892931 - 4892998
Alignment:
| Q |
63 |
aaagtccaagatctaactacctttcgtaatggatttgttcggtttggtattctgaacgtgttggattt |
130 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
4892931 |
aaagtcctagatctaactacctttcgtagtggatttgtttggtttgaggttctggacgtgttggattt |
4892998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 239 - 307
Target Start/End: Complemental strand, 36898910 - 36898839
Alignment:
| Q |
239 |
tgatgattcgatgatggtgtatgacgagggttt--gagaagttttgat-gatttgtgattaccggttttctt |
307 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| |||| |||||||| ||||||||||||| ||| ||||| |
|
|
| T |
36898910 |
tgatgattcgatgatggtgtgtgatgagggtttgagagaggttttgatagatttgtgattactggtcttctt |
36898839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0505 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0505
Description:
Target: scaffold0505; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 59 - 130
Target Start/End: Complemental strand, 12213 - 12142
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaatggatttgttcggtttggtattctgaacgtgttggattt |
130 |
Q |
| |
|
||||||||| | ||||||||||||||||| || |||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
12213 |
atataaagttctagatctaactacctttcatagtggatttgtttggtttgaggttctggacgtgttggattt |
12142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 59 - 130
Target Start/End: Complemental strand, 13087297 - 13087226
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaatggatttgttcggtttggtattctgaacgtgttggattt |
130 |
Q |
| |
|
||||||||| | ||||||||||||||||| || |||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
13087297 |
atataaagttctagatctaactacctttcatagtggatttgtttggtttgaggttctggacgtgttggattt |
13087226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 59 - 108
Target Start/End: Original strand, 13038171 - 13038220
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaatggatttgttcggtttg |
108 |
Q |
| |
|
|||||||||| | ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13038171 |
atataaagtcttaaatctatctacctttcgtaatggatttgtttggtttg |
13038220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 107
Target Start/End: Complemental strand, 153331 - 153283
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaatggatttgttcggttt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||| | ||||| |||||| ||||| |
|
|
| T |
153331 |
atataaagtcctagatctaactaccttttgaaatgggtttgtttggttt |
153283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 59 - 130
Target Start/End: Complemental strand, 5537 - 5465
Alignment:
| Q |
59 |
atataaagtccaagatctaactacctttcgtaat-ggatttgttcggtttggtattctgaacgtgttggattt |
130 |
Q |
| |
|
||||||||||| |||||||| | |||||||||| |||||||||||||| | ||||| ||||||||||||| |
|
|
| T |
5537 |
atataaagtcctagatctaaatgtctttcgtaatgggatttgttcggttcgaggttctggacgtgttggattt |
5465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University