View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20431_high_8 (Length: 219)
Name: NF20431_high_8
Description: NF20431
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20431_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 21 - 200
Target Start/End: Complemental strand, 4908530 - 4908351
Alignment:
| Q |
21 |
attcctaacatgtaaattaggtaacaagccacatcctttacccaagacactatcagaattatcattgtcataaacattgccttcgtcttcactttcttcc |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
4908530 |
attcctaacatgtaaattaggtaacaagccacatcctttacccaagacactatcagaattatcattgtcataaacatcgccttcgtcttcactttcttcc |
4908431 |
T |
 |
| Q |
121 |
tcttgacattccccagtatatggtataatatcagttaccaatggcttctttgcattctgaaccaacttgttaacatctct |
200 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4908430 |
tcttgacattccccagtatacggtataatatcagttaccaatggcttctttgcattctgaaccaacttgttaacatctct |
4908351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University