View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20432_high_2 (Length: 215)
Name: NF20432_high_2
Description: NF20432
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20432_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 5e-55; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 33 - 164
Target Start/End: Complemental strand, 4429060 - 4428924
Alignment:
| Q |
33 |
tgccccaaaatcaatattggtgaaatgcaacggagatgaacatt-----ggaatgtgattcctgatatgtctatgtacttgggagacatctgcattttca |
127 |
Q |
| |
|
||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4429060 |
tgccccaaaatcaatattggttaactgcaacggagatgaacattacattggaatgtgattcctgatatgtctatgtacttgggagacatctgcattttca |
4428961 |
T |
 |
| Q |
128 |
aaaggcggccttatgctatcaatagaattggtaagac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4428960 |
aaaggcggccttatgctatcaatagaattggtaagac |
4428924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 60 - 141
Target Start/End: Complemental strand, 4440256 - 4440175
Alignment:
| Q |
60 |
caacggagatgaacattggaatgtgattcctgatatgtctatgtacttgggagacatctgcattttcaaaaggcggccttat |
141 |
Q |
| |
|
||||||||||||| |||| ||||||| ||||||||||||| |||||| ||||||||| |||||||| ||||||||||| |
|
|
| T |
4440256 |
caacggagatgaaatttggtgtgtgattactgatatgtctataaacttggttgacatctgcgttttcaaagggcggccttat |
4440175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 162 - 197
Target Start/End: Complemental strand, 4428912 - 4428877
Alignment:
| Q |
162 |
gactggatgacttgaatgcttggttagtggctgaac |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4428912 |
gactggatgacttgaatgcttggttagtggctgaac |
4428877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University