View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20433_high_16 (Length: 341)
Name: NF20433_high_16
Description: NF20433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20433_high_16 |
 | |
|
| [»] scaffold0072 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0072 (Bit Score: 292; Significance: 1e-164; HSPs: 1)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 1 - 332
Target Start/End: Original strand, 41649 - 41980
Alignment:
| Q |
1 |
aaacctacccacaaaaggccacccagttaaaaacatcactagatctgagatgatgctgagaagagaaaaaagattatgttattattgtgatgaacgattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
41649 |
aaacctacccacaaaaggccacccagttaaaaacatcactagagctgagatgatgctcagaagagaaaaaggattatgctattattgtgatgaacgattc |
41748 |
T |
|
| Q |
101 |
tctatatctcataaatgtccaaatcgtcattatttcttatttcaaactgaagaagaagaagaacctgacccaccaccaccgcaaatcacaccatcagctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
41749 |
tctatatctcataaatgtccaaatcgtcattatttcttattccaaactgaagaagaagaagaacctgaaccaccaccacaacaaatcacaccatcagctg |
41848 |
T |
|
| Q |
201 |
accctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacggtcaaat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41849 |
accctgaaacaccacctattgttacggaggagcaccacttgtcactgaatgccttgaacggttctgctcgtaaaggcaccatgcggttccacagtcaaat |
41948 |
T |
|
| Q |
301 |
tcagggtattgctatcacgattttcttggaca |
332 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |
|
|
| T |
41949 |
tcagggtattgctatcacgattttgttggaca |
41980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University