View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20433_high_21 (Length: 269)
Name: NF20433_high_21
Description: NF20433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20433_high_21 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 55 - 269
Target Start/End: Complemental strand, 17144101 - 17143887
Alignment:
| Q |
55 |
gttaagatacaaaaattgatacgatgccaaacataaagggtcaaaagttcgtttaaacctaattattttcgtaacggaacaaattgcgtccgtgtcaaag |
154 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||| | |||||| | | ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17144101 |
gttaagatgtaaaaattgatacgatgccaaatataagagatcaaaattacatttaaacctaattattttcataacggaacaaattgcgtccgtgtcaaag |
17144002 |
T |
 |
| Q |
155 |
tgattgcatcgtaaccgtaataactagtccccactttgtctttattttcatacgtgcgacaaaaagcttttaatatgacaacaaaagaaattaatgacca |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17144001 |
tgattgcatcgtaaccgtaataactagtccccactttgtctttattttcatacgtgcgacaaaaagcttttaatatgacaacaaaagaaattaatgacca |
17143902 |
T |
 |
| Q |
255 |
aattacacttccaaa |
269 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
17143901 |
aattacacttccaaa |
17143887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 63 - 119
Target Start/End: Original strand, 317459 - 317514
Alignment:
| Q |
63 |
acaaaaattgatacgatgccaaacataaagggtcaaaagttcgtttaaacctaatta |
119 |
Q |
| |
|
|||||||||| ||||||| ||||||||| ||||||||||| ||||||| || ||||| |
|
|
| T |
317459 |
acaaaaattgctacgatgacaaacataa-gggtcaaaagtgcgtttaagccaaatta |
317514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University