View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20433_high_27 (Length: 235)
Name: NF20433_high_27
Description: NF20433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20433_high_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 9032388 - 9032622
Alignment:
| Q |
1 |
tttttggataccgctatgcaaaactatgtgcatgatttaaccaattggttcgtccattcagctctataaataggactagtatgtaatcattttatcataa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| ||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9032388 |
tttttggataccgctatgcaaaactatgtgtatgattttaccaattggttagtccattcagctctataaataggactcgtatgtaatcattttatcataa |
9032487 |
T |
|
| Q |
101 |
caatcgagcaaaattataacactcaattttcatttctgaaaacatgacagtgatgtggagtatatgtgaatcacaacaattgatttcatgtgccacgtga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9032488 |
caatcgagcaaaattataacactcaattttcatttctgaaaacatgacagtgatgtggagtatatgtgaatcacaacaattgatttcatgtgccacgtga |
9032587 |
T |
|
| Q |
201 |
tattgtgaaaagacaaaatttaacctaagtaccat |
235 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9032588 |
tattgtgtaaagacaaaatttaacctaagtaccat |
9032622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University