View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20433_high_28 (Length: 232)
Name: NF20433_high_28
Description: NF20433
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20433_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 49 - 213
Target Start/End: Original strand, 42934333 - 42934497
Alignment:
| Q |
49 |
tcaaagatgaaggtttcaatgatttttcttgtgtgcactctgctgcttctgagctcatcggcatttgctaaaactgtaagtccaccctctccccccatcg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42934333 |
tcaaagatgaaggtttcaatgatttttcttgtgtccactctgctgcttctgagctcatcggcatttgctaaaactgtaagtccaccctctccccccgctg |
42934432 |
T |
|
| Q |
149 |
agagtccaactccggctccagcaccagcacctacaccagatttcgtaaacctcactgaattactc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42934433 |
agagtccaactccggctccagcaccagcacctacaccagatttcgtaaacctcactgaattactc |
42934497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University