View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20434_high_3 (Length: 382)
Name: NF20434_high_3
Description: NF20434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20434_high_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 360
Target Start/End: Original strand, 34698852 - 34699199
Alignment:
| Q |
1 |
gagtgatttgttttggtcaaggattaacatttgtgtctcatgttctaactcatgtccgttggttccggtccaatgagttgtccaccaaaccttaaaccgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
34698852 |
gagtgatttgttttggtcaaggattaacatttgtgtctcatgttctaactcatgtccgttggttccggtccaatgagttgtccaccaaaccttaaaacgg |
34698951 |
T |
|
| Q |
101 |
aatatactcatgaaccggattcctttgagtttgccaagtggaaccacgtggtggcttttgggttcggtggtgttgaaaccaacgaagcaaccatgttgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34698952 |
aatatactcatgaaccggattcctttgagtttgccaagtggaaccacgtggtggcttttgggttcggtggtgttgaaaccaacgaagcaaccatgttgca |
34699051 |
T |
|
| Q |
201 |
acgtggtattgtagttggtgtttttgttggatttggaattatggagaaaaggggaaggggtggtggttgttatgttgggtgggacttgagtgagaaaagg |
300 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34699052 |
acgtggtattgta------------gttggatttggaattatggagaaaaggggaaggggtggtggttgttatgttgggtgggacttgagtgagaaaagg |
34699139 |
T |
|
| Q |
301 |
gtgaccatttgcaagaaaacatgagtcgtttaaggtgatggataagggtgggttagttat |
360 |
Q |
| |
|
||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34699140 |
gtggccatttgcaagaaaacatgagtcatttaaggtgatggataagggtgggttagttat |
34699199 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University