View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20434_low_6 (Length: 248)
Name: NF20434_low_6
Description: NF20434
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20434_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 54 - 235
Target Start/End: Original strand, 36352294 - 36352475
Alignment:
| Q |
54 |
atcaacacatccaatcaactttgtttctgatgaatgcacatctaatcaacattgacgtcaaggttttgaggaatgagatcttttgatgtgtgtttttcaa |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36352294 |
atcaacacatccaatcaactttgtttctgatgaatgcacatctaatcaacattgacgtcaaggttttgaggaatgagatcttttgatgtgtgtttttcaa |
36352393 |
T |
 |
| Q |
154 |
gattgtgttttaaggttcagtttactcaactagctggatgatttgactgcaaattatgtcattattttgaaatagatttatt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36352394 |
gattgtgttttaaggttcagtttactcaactagctggatgatttgactgcaaattatgtcattattttgaaatagatttatt |
36352475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University