View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_high_37 (Length: 308)
Name: NF20435_high_37
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_high_37 |
 | |
|
| [»] scaffold0016 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0016 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 94 - 180
Target Start/End: Complemental strand, 47021 - 46935
Alignment:
| Q |
94 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggtaacttgtttagtgtgtacataatatttgtccg |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| | |||||||||||||| |
|
|
| T |
47021 |
ttatctttttatctgaaccattacagtgcagccatagaagaaacatatgttaggcagcttgtttagtgtgcagataatatttgtccg |
46935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 46913 - 46861
Alignment:
| Q |
242 |
ctgcttgtgtctctggcaagataaagccaccagcagattttgtgactcttatct |
295 |
Q |
| |
|
||||||| |||||||||| ||||||| | ||||||||||||||| ||||||||| |
|
|
| T |
46913 |
ctgcttgcgtctctggca-gataaagtctccagcagattttgtggctcttatct |
46861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 17 - 130
Target Start/End: Original strand, 33714981 - 33715095
Alignment:
| Q |
17 |
agtatatagagctatggctatgttacatgaaaaa-gttttcctttcatatcgttgagtttatagatggaaatgttaatttatctttttatctgaaccatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| | ||| |||||| || |||||| |||||||||| || |||||||||| ||||| |||||||||| |
|
|
| T |
33714981 |
agtatatagagctatggctatgttacataaaaaaaggtttactttcaaattgttgagcttatagatggcaaggttaatttattgttttaactgaaccatt |
33715080 |
T |
|
| Q |
116 |
acagtgcagccatag |
130 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
33715081 |
gcagtgcagccatag |
33715095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University