View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_high_38 (Length: 308)
Name: NF20435_high_38
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 13 - 293
Target Start/End: Complemental strand, 43870044 - 43869761
Alignment:
| Q |
13 |
aatatcgatccctggttcattctttgaaaattcagttgaattttatnnnnnnnnngtgattattttacaaggctagtaaatttatcagtacgtagaacac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43870044 |
aatatcgatccctggttcattctttgaaaattcagttgaattttataaaaaaaa-gtgattattttacaaggctagtaaatttatcagtacgtagaacac |
43869946 |
T |
 |
| Q |
113 |
aaacttaccaggaaa----aatatgttcaaactttaaaacatgtcaaaaatagcattttctggaatattagctttttctacccattgttataattagttg |
208 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43869945 |
aaacttaccaggaaattaaaatatgttcaaactttaaaacatgtcaaaaatagcattttctataatggtagctttttctacccattgttataattagttg |
43869846 |
T |
 |
| Q |
209 |
aataccgtttaaccttatctttggtatcacacacagtgaagatgtcagtgatttttaaaaattacaccatagcttatgcaaaatc |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43869845 |
aataccgtttaaccttatctttggtatcacacacagtgaagatgtcagtgatttttaaaaattacaccatagcttatgcaaaatc |
43869761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University