View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_17 (Length: 414)
Name: NF20435_low_17
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 371; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 371; E-Value: 0
Query Start/End: Original strand, 1 - 399
Target Start/End: Original strand, 25089370 - 25089767
Alignment:
| Q |
1 |
ggtaacaaatgaagcagaacagaagaaagttgtgaatgccaatatgagatttcaccacaaaaatgaaagaagaccagtttctgttcctcttgtagtgaag |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25089370 |
ggtaaccaatgaagcagaacagaagaaagttgtgaatgccaatatgagatttcaccacaaaaatgaaagaagaccagtttctgttcctcttgtagtgaag |
25089469 |
T |
 |
| Q |
101 |
caatcccctacaatcagaaggaattcaaaaatttaccaaaatttctccaaacccaattcaggtaaagaaattttcagtttcattcagtcaattttgggtt |
200 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
25089470 |
caatcccctacaattagaaggaattcaaaaatttaccaaaatttctccaaacccaattcaggtaa-gaaattttcagtttcattcagtcaattttgagtt |
25089568 |
T |
 |
| Q |
201 |
taattcgttgtcctaacttcagaaaatgtgtatgttttactaatcttttaaggttcaattccaaaagaagaagaacgcagtggctttccacaaacccaaa |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25089569 |
taattcgttgtcctaacttcagaaaatgtgtgtgttttactaatcttttaaggttcaattccaaaagaagaagaacgcagtagctttccacaaacccaaa |
25089668 |
T |
 |
| Q |
301 |
acaagttgcagagtctaggtgattttcatctcaattatgtgttgacaaaatttcattcaattcaatttatatagaaaataataattatttatgatttct |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25089669 |
acaagttgcagagtctaggtgattttcatctcaattatgtgttgacaaaatttcattcaattcaatttatatagaaaataataattatttatgatttct |
25089767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University