View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_41 (Length: 299)
Name: NF20435_low_41
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_41 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 31693242 - 31692961
Alignment:
| Q |
1 |
ttatatcagctagtagtgatataactaactttatatctaatagtgtgtgcgattgtagaccgaaatttaaaacaatggcattgaatttactctttaggca |
100 |
Q |
| |
|
||||||||||| ||||||| |||||||| |||||||||||| ||| ||||||||||||||| |||||||||||||| | |||||||||||||||||||| |
|
|
| T |
31693242 |
ttatatcagctggtagtgacataactaattttatatctaattgtgcatgcgattgtagaccggaatttaaaacaatgacgttgaatttactctttaggca |
31693143 |
T |
 |
| Q |
101 |
tagtgtttttcttgctactgaataactttgccaaatttgggataactttctttctcttcttaagagtgaaaggactaatgtgccgagttgcgggtgaagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693142 |
tagtgtttttcttgctactgaataactttgccaaattcgggataactttctttctcttcttaagagtgaaaggactaatgtgccgagttgcgggtgaagc |
31693043 |
T |
 |
| Q |
201 |
agcagacttctgaaacttgattcttttagcaggagtcatacttccatttgatttaatactctttctagaaatagctctctgc |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31693042 |
agcagacttctgaaacttgattcttttagcaggagtcatacttccatttgatttaatactctttctagaaatagctctctgc |
31692961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University