View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_46 (Length: 281)
Name: NF20435_low_46
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 120 - 259
Target Start/End: Complemental strand, 45878824 - 45878685
Alignment:
| Q |
120 |
aaatgaatgagtatgggagggggtgaaaaatcagcaagcggctcaaattattatgacatgaaaattctttaaagaggtatgttatttagacctaactttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45878824 |
aaatgaatgagtatgggagggggtgaaaaatcagcaagcggctcaaattattatgacatgaaaattctttaaagaggtatgttatttagacctaactttt |
45878725 |
T |
 |
| Q |
220 |
tacaacttacgggacaagcaaatatacaaaataaggttgg |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45878724 |
tacaacttacgggacaagcaaatatacaaaataaggttgg |
45878685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 5 - 87
Target Start/End: Complemental strand, 45878994 - 45878912
Alignment:
| Q |
5 |
tgctttttattcatatattacttcatattatgagcaatttgaggggactgtgaaccattaaagggggtctaatgaccaatttt |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45878994 |
tgctttttattcatatattacttcatattatgagcaatttgaggggactgtgaaccattaaagggggtctaatgaccaatttt |
45878912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University