View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_51 (Length: 261)
Name: NF20435_low_51
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 134 - 247
Target Start/End: Complemental strand, 47207134 - 47207021
Alignment:
| Q |
134 |
cttatatttacccaagagcatttgaatgagataataataattgtatttaattagataccaagaaaacaaattgagtttaatggattaacctctacacatg |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47207134 |
cttatatttacccaagagcatttgaatgagatcatgataattgtatttaatttgataccaagagaacaaattcagtttaatggattaacctctacacatg |
47207035 |
T |
|
| Q |
234 |
tgtgtataggatat |
247 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47207034 |
tgtgtataggatat |
47207021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University