View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20435_low_51 (Length: 261)

Name: NF20435_low_51
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20435_low_51
NF20435_low_51
[»] chr4 (1 HSPs)
chr4 (134-247)||(47207021-47207134)


Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 134 - 247
Target Start/End: Complemental strand, 47207134 - 47207021
Alignment:
134 cttatatttacccaagagcatttgaatgagataataataattgtatttaattagataccaagaaaacaaattgagtttaatggattaacctctacacatg 233  Q
    |||||||||||||||||||||||||||||||| || |||||||||||||||| |||||||||| |||||||| |||||||||||||||||||||||||||    
47207134 cttatatttacccaagagcatttgaatgagatcatgataattgtatttaatttgataccaagagaacaaattcagtttaatggattaacctctacacatg 47207035  T
234 tgtgtataggatat 247  Q
    ||||||||||||||    
47207034 tgtgtataggatat 47207021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University