View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_52 (Length: 258)
Name: NF20435_low_52
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 26855254 - 26855015
Alignment:
| Q |
1 |
caacaaaagtgctgagaatgtgtgacttaagggattgtcaccataaaatatgccattagggtgaaagttttgtgcttgacacaaaatttgttcttgtaga |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26855254 |
caacagaagtgctgagaatgtgtgacttaagggattgtcaccataaaatatgccattagggtgaaagttttgtgcttgacacaaaatttgttcttgtaga |
26855155 |
T |
 |
| Q |
101 |
acacgagaaggaatagaatgtgcatgttgttgccattcattttttggtgtttgtagcaaacgatttgcagggaatagccgagtcatgcatgaatattttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26855154 |
acacgagaaggaatagaatgtgcatgttgttgccattcattttttggtgtttgtagcaaacgatttgcagggaatagccgagtcatgcatgaattttttt |
26855055 |
T |
 |
| Q |
201 |
gataataaacatgaacgttcgaaattacacatgaagaatg |
240 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
26855054 |
gataataaacatgaacattcaaaattacacatgaagaatg |
26855015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University