View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20435_low_53 (Length: 257)

Name: NF20435_low_53
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20435_low_53
NF20435_low_53
[»] chr1 (4 HSPs)
chr1 (149-250)||(4253641-4253741)
chr1 (72-107)||(4253777-4253812)
chr1 (150-187)||(22346707-22346744)
chr1 (151-187)||(37050960-37050996)
[»] chr7 (3 HSPs)
chr7 (149-188)||(41029302-41029341)
chr7 (149-183)||(8290461-8290495)
chr7 (149-182)||(30650221-30650254)
[»] chr5 (1 HSPs)
chr5 (149-188)||(781893-781932)
[»] scaffold0154 (1 HSPs)
scaffold0154 (157-187)||(37566-37596)
[»] chr8 (3 HSPs)
chr8 (149-187)||(2554204-2554242)
chr8 (149-187)||(39076551-39076589)
chr8 (149-187)||(39077037-39077075)
[»] chr3 (3 HSPs)
chr3 (149-187)||(52456512-52456550)
chr3 (149-187)||(52575978-52576016)
chr3 (159-188)||(38894067-38894096)
[»] chr2 (1 HSPs)
chr2 (149-187)||(42061416-42061454)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 149 - 250
Target Start/End: Complemental strand, 4253741 - 4253641
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttatatgcagatcaattaagttaagctcacaaggatcaatatctaattcaacatccaattttctt 248  Q
    |||||||||| |||||||||||||||||||||||||||||| ||||  |||| |||||| |||  |||||||||||||||||||||||||||||||| ||    
4253741 ggtggtcagg-ttcgaaccccggaccttgcatattttatatccagacaaattgagttaacctcggaaggatcaatatctaattcaacatccaattttttt 4253643  T
249 cg 250  Q
    ||    
4253642 cg 4253641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 72 - 107
Target Start/End: Complemental strand, 4253812 - 4253777
Alignment:
72 gacaagttttcttaaaaaatgttattaattgttatt 107  Q
    ||||||||||||||||||||||||||||||||||||    
4253812 gacaagttttcttaaaaaatgttattaattgttatt 4253777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 187
Target Start/End: Complemental strand, 22346744 - 22346707
Alignment:
150 gtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    |||||||||||| |||||||||||||||||||||||||    
22346744 gtggtcaggatttgaaccccggaccttgcatattttat 22346707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Complemental strand, 37050996 - 37050960
Alignment:
151 tggtcaggattcgaaccccggaccttgcatattttat 187  Q
    ||||| || ||||||||||||||||||||||||||||    
37050996 tggtcggggttcgaaccccggaccttgcatattttat 37050960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 188
Target Start/End: Complemental strand, 41029341 - 41029302
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttata 188  Q
    ||||||| |||||||||||||||||||||||||| |||||    
41029341 ggtggtcgggattcgaaccccggaccttgcatatattata 41029302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 8290461 - 8290495
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatatt 183  Q
    ||||||| |||||||||||||||||||||||||||    
8290461 ggtggtcgggattcgaaccccggaccttgcatatt 8290495  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 182
Target Start/End: Original strand, 30650221 - 30650254
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatat 182  Q
    |||||||| |||||||||||||||||||||||||    
30650221 ggtggtcatgattcgaaccccggaccttgcatat 30650254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 188
Target Start/End: Complemental strand, 781932 - 781893
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttata 188  Q
    |||||||||| |||||||||| ||||||||||||||||||    
781932 ggtggtcagggttcgaaccccagaccttgcatattttata 781893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0154 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0154
Description:

Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 37596 - 37566
Alignment:
157 ggattcgaaccccggaccttgcatattttat 187  Q
    |||||||||||||||||||||||||||||||    
37596 ggattcgaaccccggaccttgcatattttat 37566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Original strand, 2554204 - 2554242
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    ||||| ||||||||||||||| |||||||||||||||||    
2554204 ggtggccaggattcgaaccccagaccttgcatattttat 2554242  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 39076589 - 39076551
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    |||| ||||| ||||||||||||||||||||||||||||    
39076589 ggtgatcagggttcgaaccccggaccttgcatattttat 39076551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 39077075 - 39077037
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    |||| ||||| ||||||||||||||||||||||||||||    
39077075 ggtgatcagggttcgaaccccggaccttgcatattttat 39077037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 52456550 - 52456512
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    |||||||||| ||||||||||||||||| ||||||||||    
52456550 ggtggtcagggttcgaaccccggaccttacatattttat 52456512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 52576016 - 52575978
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    ||||||| ||||||||||||| |||||||||||||||||    
52576016 ggtggtcgggattcgaaccccagaccttgcatattttat 52575978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 188
Target Start/End: Complemental strand, 38894096 - 38894067
Alignment:
159 attcgaaccccggaccttgcatattttata 188  Q
    ||||||||||||||||||||||||||||||    
38894096 attcgaaccccggaccttgcatattttata 38894067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 42061454 - 42061416
Alignment:
149 ggtggtcaggattcgaaccccggaccttgcatattttat 187  Q
    |||||||||| ||||||||| ||||||||||||||||||    
42061454 ggtggtcagggttcgaaccctggaccttgcatattttat 42061416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University