View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_53 (Length: 257)
Name: NF20435_low_53
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_53 |
 |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 149 - 250
Target Start/End: Complemental strand, 4253741 - 4253641
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttatatgcagatcaattaagttaagctcacaaggatcaatatctaattcaacatccaattttctt |
248 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |||| |||| |||||| ||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
4253741 |
ggtggtcagg-ttcgaaccccggaccttgcatattttatatccagacaaattgagttaacctcggaaggatcaatatctaattcaacatccaattttttt |
4253643 |
T |
 |
| Q |
249 |
cg |
250 |
Q |
| |
|
|| |
|
|
| T |
4253642 |
cg |
4253641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 72 - 107
Target Start/End: Complemental strand, 4253812 - 4253777
Alignment:
| Q |
72 |
gacaagttttcttaaaaaatgttattaattgttatt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
4253812 |
gacaagttttcttaaaaaatgttattaattgttatt |
4253777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 187
Target Start/End: Complemental strand, 22346744 - 22346707
Alignment:
| Q |
150 |
gtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22346744 |
gtggtcaggatttgaaccccggaccttgcatattttat |
22346707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 151 - 187
Target Start/End: Complemental strand, 37050996 - 37050960
Alignment:
| Q |
151 |
tggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcatattttat |
37050960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000006; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 188
Target Start/End: Complemental strand, 41029341 - 41029302
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttata |
188 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
41029341 |
ggtggtcgggattcgaaccccggaccttgcatatattata |
41029302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 183
Target Start/End: Original strand, 8290461 - 8290495
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatatt |
183 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
8290461 |
ggtggtcgggattcgaaccccggaccttgcatatt |
8290495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 182
Target Start/End: Original strand, 30650221 - 30650254
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatat |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
30650221 |
ggtggtcatgattcgaaccccggaccttgcatat |
30650254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 149 - 188
Target Start/End: Complemental strand, 781932 - 781893
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttata |
188 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
781932 |
ggtggtcagggttcgaaccccagaccttgcatattttata |
781893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 187
Target Start/End: Complemental strand, 37596 - 37566
Alignment:
| Q |
157 |
ggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
37596 |
ggattcgaaccccggaccttgcatattttat |
37566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Original strand, 2554204 - 2554242
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
2554204 |
ggtggccaggattcgaaccccagaccttgcatattttat |
2554242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 39076589 - 39076551
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
39076589 |
ggtgatcagggttcgaaccccggaccttgcatattttat |
39076551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 39077075 - 39077037
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
39077075 |
ggtgatcagggttcgaaccccggaccttgcatattttat |
39077037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 52456550 - 52456512
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
52456550 |
ggtggtcagggttcgaaccccggaccttacatattttat |
52456512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 52576016 - 52575978
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
52576016 |
ggtggtcgggattcgaaccccagaccttgcatattttat |
52575978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 159 - 188
Target Start/End: Complemental strand, 38894096 - 38894067
Alignment:
| Q |
159 |
attcgaaccccggaccttgcatattttata |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38894096 |
attcgaaccccggaccttgcatattttata |
38894067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 149 - 187
Target Start/End: Complemental strand, 42061454 - 42061416
Alignment:
| Q |
149 |
ggtggtcaggattcgaaccccggaccttgcatattttat |
187 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
42061454 |
ggtggtcagggttcgaaccctggaccttgcatattttat |
42061416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University