View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_56 (Length: 253)
Name: NF20435_low_56
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 18 - 120
Target Start/End: Complemental strand, 30847139 - 30847037
Alignment:
| Q |
18 |
aattaaccttacacatttctcaccaacttagtgtatatttggattctattgagtttgaaaaaatcaccatgaaccattatgatttataaaattataaaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30847139 |
aattaaccttacacatttctcaccaacttagtgtatatttggattctattgagtttgaaaaaatcaccatcaaccactatgatttataaaattataaaag |
30847040 |
T |
 |
| Q |
118 |
tta |
120 |
Q |
| |
|
||| |
|
|
| T |
30847039 |
tta |
30847037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 207 - 253
Target Start/End: Complemental strand, 30847018 - 30846972
Alignment:
| Q |
207 |
aagattctcttaaatgatttttgagtaaaataaattttgatcagatt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30847018 |
aagattctcttaaatgatttttgagtaaaataaattttgatcagatt |
30846972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University