View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_62 (Length: 215)
Name: NF20435_low_62
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_62 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 27 - 199
Target Start/End: Original strand, 7624937 - 7625110
Alignment:
| Q |
27 |
taatgaaagtgaaatttcataaaagtttactttttg-tgtcaatgtgacggattcttagttggtggaagcggttgttgtgttgaatcgcaagattgatat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7624937 |
taatgaaagtgaaatttcataaaagtttactttttgatgtcaatgtgacggattcttagttggtggaagcggttgttgtgttgaatcgcaagattgatat |
7625036 |
T |
|
| Q |
126 |
tttttattccttttggttacatctatttgcctattggatgggatcctcgtaggttgtttttctagcagactttg |
199 |
Q |
| |
|
| ||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
7625037 |
tgtttattccttttgtttacatctatttgcctattggatgagatcctcgtaggttgtctttccagcagactttg |
7625110 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 33306909 - 33306941
Alignment:
| Q |
1 |
aaccaaattgaacttatgcttatgtataatgaa |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
33306909 |
aaccaaattgaacttatgcttatttataatgaa |
33306941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University