View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20435_low_66 (Length: 210)
Name: NF20435_low_66
Description: NF20435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20435_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 16 - 192
Target Start/End: Complemental strand, 2895358 - 2895182
Alignment:
| Q |
16 |
taggacaagaaataaccaaatgttgagcagtctcgatacagccgcaatcagtcacacaatgctgaatctcgagaggagttgtaaactcaagatcaagact |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2895358 |
taggacaagaaataaccaaatgttgagcagtctcgatatagccgcaatcagtcacacaatgctgaatctcgagaggagttgtaaactcaagatcaagact |
2895259 |
T |
 |
| Q |
116 |
ccacaatccggagttgtaaatgctcacatatcttcaagnnnnnnnacacctatgtattttcaaaatatggagttgta |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
2895258 |
ccacaatccggagttgtaaatgctcacatatcttcaagtttttttacacctatgaattttcaaaatatggagttgta |
2895182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University