View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20436_high_10 (Length: 386)
Name: NF20436_high_10
Description: NF20436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20436_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 13 - 58
Target Start/End: Complemental strand, 12034512 - 12034467
Alignment:
| Q |
13 |
taggagatgagcatgcctctctgcgcaacacattagaggaaataca |
58 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12034512 |
taggagatgagcatgcctctctacgcaacacattagaggaaataca |
12034467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 75 - 115
Target Start/End: Complemental strand, 12034422 - 12034382
Alignment:
| Q |
75 |
tgtgtgatgcacaactctttttgcgcaattgcacaacccac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12034422 |
tgtgtgatgcacaactctttttgcgcaatcgcacaacccac |
12034382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University