View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20436_low_14 (Length: 323)
Name: NF20436_low_14
Description: NF20436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20436_low_14 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 323
Target Start/End: Complemental strand, 34612968 - 34612642
Alignment:
| Q |
1 |
atctaccatcaacaaattggtatttgttcatgaggaa---caaagcccgtttcatagaacgggtccaaacattataattggaaccggtgtgaagttgcaa |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34612968 |
atctaccatcaacaaattggtatttgttcatgaggaagaacaaagcccgtttcatagaacgggtccaaacattataattggaaccggtgtgaagttgcaa |
34612869 |
T |
 |
| Q |
98 |
aattatcactgaagtgggactctcactcggacgaatatagaaaggattggcttgaatctcagaaatctgagttgctgccaacgcggcggaagcatcactg |
197 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
34612868 |
aattatcactgaagtgggactctcacttggacgaatatagaaaggattggcctgaatctcagaaatctgagttgctgtcaacacggcggaagcatcactg |
34612769 |
T |
 |
| Q |
198 |
cagccaccggagccattagctcgaaccatttgtgatgtgcagcagaactcttaaaaagagttctaattctgttcatagaagagctctta-taccatcaaa |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34612768 |
cagccaccggagccattagctcgaaccatttgtgatgtgcagcagaactattaaaaagagttctaattctgttcatagaagagctcttattaccatcaaa |
34612669 |
T |
 |
| Q |
297 |
gtagagagaaaagaatgattcatatcc |
323 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34612668 |
gtagagagaaaagaatgattcatatcc |
34612642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University