View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20436_low_19 (Length: 257)
Name: NF20436_low_19
Description: NF20436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20436_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 12 - 240
Target Start/End: Original strand, 27641747 - 27641977
Alignment:
| Q |
12 |
agagataagtgggttttaggtaagctctaacgatttcagaatatcgttatagaaaattattaggcttaaatatgcaaatagtctttccaaatattaaggg |
111 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| ||||||||| ||||| |
|
|
| T |
27641747 |
agagataagtgggtttcaggtaagctctaacgatttcagaatatcgttatagaaaattattaggtttaaatatgtaaatagtctctccaaatatgaaggg |
27641846 |
T |
|
| Q |
112 |
tttcggttttagtccttgtggccgaaataaaagattccatatatgtaaagactaaaaccaaaacatttg--atttgcaaggaccacgttaaattacaacc |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
27641847 |
tttcggttttagtccttgtggccgaaacaaaagattacatatctgtaaagactaaaaccaaaacatttgatatttgcaaggaccaggttaaattacaacc |
27641946 |
T |
|
| Q |
210 |
gatcaagtttgggtatatatatgaaactagt |
240 |
Q |
| |
|
|| | || ||||||||||||||||||||||| |
|
|
| T |
27641947 |
gaccgaggttgggtatatatatgaaactagt |
27641977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University