View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20436_low_20 (Length: 251)
Name: NF20436_low_20
Description: NF20436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20436_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 12 - 233
Target Start/End: Complemental strand, 24990780 - 24990559
Alignment:
| Q |
12 |
gcataggtggaccggaaggtatgaagctcatttatgggataaagggacatggaatcctactcaaaagaaaaagggaaagcaaggtagatttttaatgcat |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24990780 |
gcataggtggactggaaggtatgaagctcatttatgggataaagggacatggaatcctactcaaaagaaaaagggaaagcaaggtagatttttaatgcat |
24990681 |
T |
|
| Q |
112 |
tgtttacttcacgttcatcggctagaaataatttttaaaaagattttaattatcgtaaaattgtcatccaacgtgagactcttaacatttcctgtcattt |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24990680 |
tgtttacttcacgttcatcggctagaaatgatttttaaaaagattttaattatcgtaaaattgtcatcgaacgtgagactcttaacatttcctgtcattt |
24990581 |
T |
|
| Q |
212 |
aatgttcttgcatgtgatcttt |
233 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
24990580 |
aatgctcttgcatgtgatcttt |
24990559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 53
Target Start/End: Complemental strand, 16869955 - 16869915
Alignment:
| Q |
13 |
cataggtggaccggaaggtatgaagctcatttatgggataa |
53 |
Q |
| |
|
||||| ||||||||||||| |||||||||| |||||||||| |
|
|
| T |
16869955 |
catagatggaccggaaggtttgaagctcatctatgggataa |
16869915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University