View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20436_low_26 (Length: 207)
Name: NF20436_low_26
Description: NF20436
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20436_low_26 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 14 - 139
Target Start/End: Complemental strand, 32756537 - 32756412
Alignment:
| Q |
14 |
aatatgctagaggggatactgatgtattttatattggggtagtgtcatctaagtacacagtagaaaaattccattaattaatctcatttagtttattgat |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
32756537 |
aatatgctagaggggatactgatgtattttatattggggtagtgtcatctaagtacacggtagaataattccattaattaatctcatttagtttattgat |
32756438 |
T |
|
| Q |
114 |
gcatgttacagtagctcgaagaatac |
139 |
Q |
| |
|
||||||||||||||||| |||||||| |
|
|
| T |
32756437 |
gcatgttacagtagctcaaagaatac |
32756412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University