View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_high_27 (Length: 363)
Name: NF20437_high_27
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 15 - 344
Target Start/End: Complemental strand, 22556026 - 22555691
Alignment:
| Q |
15 |
actcattgatttgtaggttatctctacacatttctcacgtttacactaccattatttgctaatttgnnnnnnn----gttgtcaggaacattcaagaaaa |
110 |
Q |
| |
|
||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
22556026 |
actcattgatttgtatgttatctctacgcatttctcacgtttacactaccattatttgctaatttgttttttttgttgctgtcaggaacattcaagaaaa |
22555927 |
T |
 |
| Q |
111 |
tctgtttagtggcattctcccacaacattttcagtccattccaaacctatggttagaagt---cttgatcacctgcaatttctttattgcatatgaaata |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| || |||||||||||||||||| |||||||||| |
|
|
| T |
22555926 |
tctgtttagtggcattctcccacaacattttcagtccattccaaacctatggttagtagtagtcttgctcgcctgcaatttctttattggatatgaaata |
22555827 |
T |
 |
| Q |
208 |
atgaacaaatnnnnnnnntactatttactcttcattaggattggaagcaatatgttccatgcagcggacggctctcctccttggggatttcctttggacg |
307 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22555826 |
atgaacaaataaaaaaa-tactatttactcttcattaggattggaagcaatatgttccatgcagcggacggctctcctccttggggatttcctttggacg |
22555728 |
T |
 |
| Q |
308 |
atgtaccacttgaacacaatatcagtcacccacccac |
344 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
22555727 |
atgtaccacttgaacacaatatcagtcgcccacccac |
22555691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University