View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_high_50 (Length: 243)
Name: NF20437_high_50
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 7724147 - 7724357
Alignment:
| Q |
18 |
tcctttggtggagtgagaatgtgagataattctatattcttagtttgtcnnnnnnnnnnnnatcgactactttaattaactttctctttcagttagatgt |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724147 |
tcctttgatggagtgagaatgtgagataattctatattcttagtttgtctttttattttttatcgactactttaattaactttctctttcagttagatgt |
7724246 |
T |
|
| Q |
118 |
ataacaacctacttcnnnnnnnnnnnnacaaagacttgcatatacactatctcaattgcaagtctatagtgtgcatgaaatactatacatatttgttgtt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7724247 |
ataacaacctactt-----tttttttcacaaagacttgcatatacactatctcaattgcaagtctatagtgtgcatgaaatactatacatatttgttgtt |
7724341 |
T |
|
| Q |
218 |
tttatttatatatatt |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7724342 |
tttatttatatatatt |
7724357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University