View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_high_53 (Length: 236)
Name: NF20437_high_53
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_high_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 40 - 118
Target Start/End: Original strand, 19063457 - 19063535
Alignment:
| Q |
40 |
ttaagtgtaagtattatgtttaccgcttaaaatgaaatcacttttagctctccaaacattgaatccaaacatgaactta |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19063457 |
ttaagtgtaagtattaagtttaccgcttaaaatgaaatcacttttagctctccaaacattgaatccaagcatgaactta |
19063535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 173 - 218
Target Start/End: Original strand, 19064647 - 19064693
Alignment:
| Q |
173 |
ttgttgtgtaatgatttatagaa-tccttttaatttagtcacaattg |
218 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19064647 |
ttgttgtgtagtgatttatagaaatccttttaatttagtcacaattg |
19064693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 75 - 116
Target Start/End: Complemental strand, 5899248 - 5899207
Alignment:
| Q |
75 |
aatcacttttagctctccaaacattgaatccaaacatgaact |
116 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||||||| |
|
|
| T |
5899248 |
aatcacttttaactctcccaaaattgaatccaaacatgaact |
5899207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University