View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_high_65 (Length: 210)
Name: NF20437_high_65
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_high_65 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 34969920 - 34970118
Alignment:
| Q |
1 |
agtgaaaagggcactattttgttgtttcgtccatggctccaaaatttttaagatcaaccttgccactactgcatgttttccgaccattacatga--nnnn |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34969920 |
agtgaaaagggcactattttgttgtttcgttcatggctccaaaattttaaagatcaaccttgccactactccatgttttccgaccattacatgatttatt |
34970019 |
T |
 |
| Q |
99 |
nnnnnnggtcagatcattacatgatttaattgggtcgacgataattcatgaggactttgctat-aaaaagagtcgtgcaaatagcattgttgttctttt |
196 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34970020 |
ttttttggtcagaccattacatgatttaattgggtcgacgataattcatgaggactttgctataaaaaagtgtcgtgcaaataacattgttgttctttt |
34970118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University