View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_24 (Length: 373)
Name: NF20437_low_24
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 361
Target Start/End: Complemental strand, 30872144 - 30871786
Alignment:
| Q |
1 |
ttcaaattattgtttatcacgttctagaattctaacctcttccactaaactcgatctcattcatgatgttgtcatagtgtgtccnnnnnnnntgttatca |
100 |
Q |
| |
|
|||||||| || ||| | ||||| ||||||| |||||||||||| |||||||||||| |||||||||||||||||||||||||| |||| ||| |
|
|
| T |
30872144 |
ttcaaatttttatttgttacgttgtagaattttaacctcttccattaaactcgatcttattcatgatgttgtcatagtgtgtccaaaacaaatgttgtca |
30872045 |
T |
 |
| Q |
101 |
tacctatagcatgacattgacatggtagagttcaacaaccccaaaccattgagggtccattaagggtcccatatatttgatcatctcagtgcagattgcc |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30872044 |
tagctatagcatgacattgacatggtagagttcaacaaccccaaaccattgagggtccattaagggtcccatatatttgatcatctcagtgcagattgcc |
30871945 |
T |
 |
| Q |
201 |
acatttcttatcccaaataaattttaccatatatccttatcactcacattattgttttatattatatgagtttttatagagnnnnnnnntgggcacagga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
30871944 |
acatttcttatcccaaataaattttaccatatatcctcatcactcacattattgttt--tattatatgagtttttatagagaaaaaaaatgggcacagga |
30871847 |
T |
 |
| Q |
301 |
tttgggaccatccttcaacctgttatctgccacttccacttgttatctagcattccctctc |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30871846 |
tttgggaccatccttcaacctgttatctgccacttccacttgttatctagcattccctctc |
30871786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University