View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_25 (Length: 372)
Name: NF20437_low_25
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_25 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 13 - 356
Target Start/End: Complemental strand, 40077548 - 40077205
Alignment:
| Q |
13 |
ataatactcattttccatatagatcttcatcgtccatttgtcctctcccatcgcaatcaagtaagcaagcgccgtctggtcatcagaatcaggtacaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40077548 |
ataatactcattttccatatagatcttcttcgtccatttgtcctctcccatcgcaatcaagtaagcaagcgcagtctggtcatcagaatcaggtacaact |
40077449 |
T |
|
| Q |
113 |
tttgtcttgaaagttgctctcaacctctcaccccatttctcgtattctggactgtttgggcccatactggcccaaacatccataaagtccaacgaccact |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077448 |
tttgtcttgaaagttgctctcaacctctcaccccatttctcgtattctggactgtttgggcccatactggcccaaacatccataaagtccaacgaccact |
40077349 |
T |
|
| Q |
213 |
gacaattcctcatcaagaaaacacccgcgtttagcccagtccagctatgttctttctttaccaactcttcccaaccatgaatcacaaggttgtgatcatt |
312 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40077348 |
gacaattcctaatcaagaaaacacccgcgtttagcccagtccagctatgttctttctttaccaactcttcccaaccatgaatcacaaggttgtgatcatt |
40077249 |
T |
|
| Q |
313 |
gtaacgccataacggtaacttgaactccatgtcagtgaagatgg |
356 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40077248 |
gtaacgccataagggtaacttgaactccatgtcagtgaagatgg |
40077205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University