View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_32 (Length: 340)
Name: NF20437_low_32
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_32 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 45 - 160
Target Start/End: Original strand, 5262166 - 5262281
Alignment:
| Q |
45 |
tcctttcaatggatcgccaaccaaagctgaattaatttgaatgagttcagaaacaaagaatgagaagaaggaagtgtgggcacatacataaagagggaca |
144 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5262166 |
tcctttcaatgtatcaccaaccaaagctgaattaatttgaatgagttcagaaacaaagagtgagaagaaggaagtgtgggcacatacataaagagggaca |
5262265 |
T |
|
| Q |
145 |
agaagacaataggttg |
160 |
Q |
| |
|
|||||||||| ||||| |
|
|
| T |
5262266 |
agaagacaatgggttg |
5262281 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 194 - 335
Target Start/End: Original strand, 5262276 - 5262417
Alignment:
| Q |
194 |
gggttggatgggccagcataaaatttgttttaaaatcagagatattttttgtcatttacctgt-gnnnnnnnnnttccttttgaatgggatgagtcgtgg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
5262276 |
gggttggatgggccagcataaaatttgttttaaaatcagagatattttt-gtcatttatctgtagaaaaaaaaattccttttgaatgggatgagtcgtgg |
5262374 |
T |
|
| Q |
293 |
ccaacccgtgcctttgtaatgcttcgttattgttcttctctct |
335 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5262375 |
tcaacccgtgcctttgtaatgcttcgctattgctcttctctct |
5262417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University