View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_43 (Length: 285)
Name: NF20437_low_43
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 59; Significance: 5e-25; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 197 - 259
Target Start/End: Original strand, 55144558 - 55144620
Alignment:
| Q |
197 |
gggtcactcaatgttatatagttttgttaaatttcaaatgtattgttccgatctcaaaccaca |
259 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
55144558 |
gggtcactcaatgttatatagttttgttgaatttcaaatgtattgttccgatctcaaaccaca |
55144620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 125 - 168
Target Start/End: Original strand, 55144485 - 55144528
Alignment:
| Q |
125 |
ccaagttattattaataagttgtgagtggtattagttaacctgc |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55144485 |
ccaagttattattaataagttgtgagtggtattagttaacctgc |
55144528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 55144361 - 55144393
Alignment:
| Q |
1 |
aatgagaatcacatatattcctatattactgcc |
33 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
55144361 |
aatgagaatcacatatattcctatattactgcc |
55144393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University