View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_44 (Length: 284)
Name: NF20437_low_44
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_44 |
 |  |
|
| [»] scaffold0272 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0272 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 18 - 274
Target Start/End: Original strand, 6237 - 6493
Alignment:
| Q |
18 |
ataagtaatgcagaaacataagaaatatacacaccatattgctacatatttaatactgaagatcgacatggaaaacatcaaatacttaaacaagatgtag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6237 |
ataagtaatgcagaaacataagaaatatacacaccatattgctacatatttaatactgaagatcgacatggaaaacatcaaatacttaaacaagatgtag |
6336 |
T |
 |
| Q |
118 |
agcatgtatatccccacgatcgctgcttctacgtttgtaaccatgtcgttgccgctcgcctccctcttctacatagactgttgtttctctatttctgcag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6337 |
agcatgtatatccccacgatcgctgcttctacgtttgtaaccatgtcgttgccgctcgcctccctcttctacatagactgttgtttctctatttctgcag |
6436 |
T |
 |
| Q |
218 |
gttacaaaagttgaagtaagattaaaccatatgagttgtgcattatttgtctctgtg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6437 |
gttacaaaagttgaagtaagattaaaccatatgagttgtgcattatttgtctttgtg |
6493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University