View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_48 (Length: 264)
Name: NF20437_low_48
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_48 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 247; Significance: 1e-137; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 247
Target Start/End: Complemental strand, 52771126 - 52770880
Alignment:
| Q |
1 |
cagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaactc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771126 |
cagcatcaaatgctaccggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaactc |
52771027 |
T |
 |
| Q |
101 |
agagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52771026 |
agagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttctgtt |
52770927 |
T |
 |
| Q |
201 |
gctgaagctttagggactggtcctactttcttgattcttgctgtaat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52770926 |
gctgaagctttagggactggtcctactttcttgattcttgctgtaat |
52770880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 52767145 - 52766921
Alignment:
| Q |
18 |
ggatggcttgcagttttgggtttgatactgtatatagcttttttctcccctgggatgggaccagtgccgtgggcaatgaactcagagatatatcctaaag |
117 |
Q |
| |
|
||||||||||| ||| | |||||| || ||||| || |||||||| || |||||||| || |||||||||||| | ||||| || ||||||| | | |
|
|
| T |
52767145 |
ggatggcttgcggttgttggtttggccctatatattgcatttttctcgccagggatggggcctgtgccgtgggcagtaaactctgaagtatatccgcagg |
52767046 |
T |
 |
| Q |
118 |
aatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttctttctgttgctgaagctttagggac |
217 |
Q |
| |
|
| || ||||||| ||||| || ||||||||||||||| |||| |||| ||| | |||||| ||||| |||||||||| |||| |||||| |||||| |
|
|
| T |
52767045 |
agtaccgaggaatgtgtggagggatgtcagctactgtgaattggatttcaaatttgattgtggctcagtcatttctttccattgcagaagctgcagggac |
52766946 |
T |
 |
| Q |
218 |
tggtcctactttcttgattcttgct |
242 |
Q |
| |
|
||||||||| |||||| |||||||| |
|
|
| T |
52766945 |
tggtcctacattcttgcttcttgct |
52766921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 96 - 244
Target Start/End: Original strand, 392778 - 392926
Alignment:
| Q |
96 |
aactcagagatatatcctaaagaatatagaggaatttgtggtggtatgtcagctactgtgtgttgggtttccaatctcattgtgtctcagacatttcttt |
195 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| || ||||| || ||| |||| || ||||||||| |||| ||| | || ||||| ||| ||||||| |
|
|
| T |
392778 |
aactcagagatatatcctgaagaatatcgaggtatatgtgggggcatggcagcgaccgtgtgttggatttcaaatttgatcgtgtccgagagctttcttt |
392877 |
T |
 |
| Q |
196 |
ctgttgctgaagctttagggactggtcctactttcttgattcttgctgt |
244 |
Q |
| |
|
| ||||||| ||| | |||| || | | |||||||||||| ||||||| |
|
|
| T |
392878 |
cgattgctgacgctatcgggattgcttcaactttcttgattattgctgt |
392926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University