View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_51 (Length: 245)
Name: NF20437_low_51
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_51 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 28082918 - 28083159
Alignment:
| Q |
1 |
ctttttactctcgttatctctgttgccaaagattcattccgccccttcctttttcaccgatgaaatctacaaggaacttaagagtatcgctgnnnnnnng |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28082918 |
ctttttactctctttatctctgttgccaaagattcattccgccccttcctttttcaccgatgaaatctacaaggaacttaagagtatcgctgtttttttg |
28083017 |
T |
 |
| Q |
101 |
aatcaggatattaaatccagtttaagtttctgcattaaggatccgtatgccgtctacattcacttatttaaataattttttnnnnnnnctcatccggact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28083018 |
aatcaggatattaaatccagtttaagtttctgcattaaggatccgtat---gtctacattcacttatttaaataatttttttaaaaaactcatccggact |
28083114 |
T |
 |
| Q |
201 |
aaggacatattaataggtgttgaatcccaccgtccacttgcggga |
245 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
28083115 |
aaggacatattaataggtgtccaatcccaccgtccacctgcggga |
28083159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University