View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_53 (Length: 243)
Name: NF20437_low_53
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 46 - 138
Target Start/End: Complemental strand, 40179465 - 40179373
Alignment:
| Q |
46 |
atgtcaaaatcatttttatgcgtttggaatcacttttgtctctccttaccgtgaagccaaacacatgacaattctaggttatgtttggtgttt |
138 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40179465 |
atgtcaaaattgtttttatgcgtttggaatcacttttgtctctccttaccgtgaagccaaacacatgacaattctaggttgtgtttggtgttt |
40179373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 197 - 238
Target Start/End: Complemental strand, 40179374 - 40179333
Alignment:
| Q |
197 |
ttctttgaaatgcatttgcttaatagaggttcacctttgtta |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40179374 |
ttctttgaaatgcatttgcttaatagaagttcacctttgtta |
40179333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 134 - 192
Target Start/End: Original strand, 9161957 - 9162015
Alignment:
| Q |
134 |
tgtttggacgaaaccttctagatagggaatgctattttttaagggatttaaaatgcttt |
192 |
Q |
| |
|
|||||||||||||| ||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
9161957 |
tgtttggacgaaacattctacacagggaacactattttttaagggatttaaaatgcttt |
9162015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 94
Target Start/End: Original strand, 9161889 - 9161940
Alignment:
| Q |
43 |
aatatgtcaaaatcatttttatgcgtttggaatcacttttgtctctccttac |
94 |
Q |
| |
|
||||||||||||||| ||||| ||| || |||||||||||||||||||||| |
|
|
| T |
9161889 |
aatatgtcaaaatcaaatttatacgtctgaaatcacttttgtctctccttac |
9161940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 43 - 92
Target Start/End: Complemental strand, 9129321 - 9129272
Alignment:
| Q |
43 |
aatatgtcaaaatcatttttatgcgtttggaatcacttttgtctctcctt |
92 |
Q |
| |
|
||||||| | ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
9129321 |
aatatgttagaatcaaatttatgcgtctggaatcacttttgtctctcctt |
9129272 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 43 - 92
Target Start/End: Original strand, 9181205 - 9181254
Alignment:
| Q |
43 |
aatatgtcaaaatcatttttatgcgtttggaatcacttttgtctctcctt |
92 |
Q |
| |
|
||||||| | ||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
9181205 |
aatatgttagaatcaaatttatgcgtctggaatcacttttgtctctcctt |
9181254 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University