View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_58 (Length: 228)
Name: NF20437_low_58
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 16 - 211
Target Start/End: Original strand, 47846420 - 47846612
Alignment:
| Q |
16 |
aatatggttgtaaaatatgttgatcagaaattaaattagatgaagaattctgatcactccttcttccattgctctcatgattagcactagctaataattt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846420 |
aatatggttgtaaaatatgttgatcagaaattaaattagatgaagaattct---cactccttcttccattgctctcatgattagcactagctaataattt |
47846516 |
T |
 |
| Q |
116 |
attacgtgcttgtaattgttgttctttacgatgcttccctaaaagcttctttttcagttttgtgttccaatagttctttatatcattatcggttct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47846517 |
attacgtgcttgtaattgttgttctttacgatgcttcccaaaaagcttctttttcagttttgtgttccaatagttctttatatcattatcggttct |
47846612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 159 - 211
Target Start/End: Original strand, 14778734 - 14778786
Alignment:
| Q |
159 |
agcttctttttcagttttgtgttccaatagttctttatatcattatcggttct |
211 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||| | |||||| || ||||| |
|
|
| T |
14778734 |
agcttctttttcagctttgtgttccaattgttcttaacatcattgtctgttct |
14778786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 115 - 211
Target Start/End: Complemental strand, 4686218 - 4686122
Alignment:
| Q |
115 |
tattacgtgcttgtaattgttgttctttacgatgcttccctaaaagcttctttttcagttttgtgttccaatagttctttatatcattatcggttct |
211 |
Q |
| |
|
|||||||||||||| |||||| |||||||| || ||||| |||||||||||||||| |||| ||||||||||||||||| |||||||| ||||| |
|
|
| T |
4686218 |
tattacgtgcttgttgttgttgatctttacggtgtttccccaaaagcttctttttcaaccttgtattccaatagttctttatgtcattatcagttct |
4686122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 212
Target Start/End: Original strand, 4609846 - 4609902
Alignment:
| Q |
156 |
aaaagcttctttttcagttttgtgttccaatagttctttatatcattatcggttctg |
212 |
Q |
| |
|
|||| |||||| ||||||||||||||||||||||| || | |||||| || |||||| |
|
|
| T |
4609846 |
aaaatcttcttcttcagttttgtgttccaatagtttttcacatcattgtctgttctg |
4609902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 210
Target Start/End: Original strand, 40253987 - 40254042
Alignment:
| Q |
155 |
taaaagcttctttttcagttttgtgttccaatagttctttatatcattatcggttc |
210 |
Q |
| |
|
|||||| ||||| |||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40253987 |
taaaagtttcttcttcaactttgtgttccaatagttctttatatcattatccgttc |
40254042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University