View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_64 (Length: 218)
Name: NF20437_low_64
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_64 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 97; Significance: 8e-48; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 103 - 203
Target Start/End: Complemental strand, 47404312 - 47404212
Alignment:
| Q |
103 |
agttagaagtcaatagaaaatcattgctttggtgttggtacgtgcactaagtgattctagaggtcattttataaaagcaagaacagcttggtatgatggt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47404312 |
agttagaagtcaatagaaaatcattgctttggtgttggtacgtgcactaagtgattctagaggtcattttataaaagcaaggacagcttggtatgatggt |
47404213 |
T |
|
| Q |
203 |
g |
203 |
Q |
| |
|
| |
|
|
| T |
47404212 |
g |
47404212 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 16 - 73
Target Start/End: Complemental strand, 47404399 - 47404342
Alignment:
| Q |
16 |
gaagataagttcttgctatatgggtaccctagttgttgcagttgcaagcaaagagtgt |
73 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47404399 |
gaagataagttcttgctatatgggcaccctagttgttgcagttgcaagcaaagagtgt |
47404342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University