View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20437_low_71 (Length: 206)
Name: NF20437_low_71
Description: NF20437
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20437_low_71 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 11 - 171
Target Start/End: Original strand, 1531536 - 1531696
Alignment:
| Q |
11 |
gcaaaggtgggatgatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatgcttcttcaagaccttga |
110 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531536 |
gcaaaggtgggagaatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatgcttcttcaagaccttga |
1531635 |
T |
 |
| Q |
111 |
agatattcaagttttagttttctagtttatggcagcagtaataggattatgtctttatatt |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1531636 |
agatattcaagttttagttttctagtttatggcagcagtaataggattatgtctttatatt |
1531696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 93
Target Start/End: Complemental strand, 23053686 - 23053606
Alignment:
| Q |
11 |
gcaaaggtgggatgatttggttcaacagatgaaagatataaggaatgttgtggcaaacaagttttttagccaatcaagttatg |
93 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||| ||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
23053686 |
gcaaaggtggaatgatttggttcaacatatgaaagatataaagaatgttgtggcaaacaag--ttttagtcaatcaagttatg |
23053606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University