View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20438_high_7 (Length: 271)
Name: NF20438_high_7
Description: NF20438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20438_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 7e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 125 - 253
Target Start/End: Complemental strand, 6415621 - 6415493
Alignment:
| Q |
125 |
tcatggtaactcaaattcgggattctttgtatatcttaatgggttcgtgatttctatccagattataaaaaacattctaatgaacatgtttagatttgtt |
224 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
6415621 |
tcatggaaactcaaattcgcgattctttgtatatctcaatgggttcgtgatttctatccagattataaaaaacattctaatgatcatgtttagatttgtt |
6415522 |
T |
 |
| Q |
225 |
taagtgatatcccttaggaatatttacgt |
253 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
6415521 |
taagtgatatcccttaggaatattgacgt |
6415493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 3 - 118
Target Start/End: Complemental strand, 6415803 - 6415688
Alignment:
| Q |
3 |
gatttaaaagaaatcgaacaatgaaatagagaggaagaagggggcgttcaatcatggggaagagagaatttgatatatccggtctagagtgcactcactc |
102 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6415803 |
gatttaaaagaaattgaacaatgaaatagagaggaagaagggggtgttcaatcacggggaagagagaatttgatatatccggtctagagtgcactcactc |
6415704 |
T |
 |
| Q |
103 |
atgcacggtacacaat |
118 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
6415703 |
atgcacgatacacaat |
6415688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University