View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20438_low_13 (Length: 237)
Name: NF20438_low_13
Description: NF20438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20438_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 29 - 219
Target Start/End: Complemental strand, 33193851 - 33193647
Alignment:
| Q |
29 |
ttagagagtgctttcataacacccactagaca-------ctagaaagcatatatgaattctgaaaactcaccctcaaccattacaataatgacttgaaga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193851 |
ttagagagtgctttcataacacccactagacagtagacactagaaagcatatatgaattctgaaaactcaccctcaaccattacaataatgacttgaaga |
33193752 |
T |
|
| Q |
122 |
gca-nnnnnnnncactactagtagtatcaaagag------tatagcatatagaaatagcaaaggaaatgtgggttgctccaataccacctactaaatgac |
214 |
Q |
| |
|
||| |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33193751 |
gcatttttttttcactactagtagtatcaaagagtatagctatagcatataaaaatagcaaaggaaatgtgggttgctccaataccacctactaaatgac |
33193652 |
T |
|
| Q |
215 |
tatat |
219 |
Q |
| |
|
||||| |
|
|
| T |
33193651 |
tatat |
33193647 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University